In frame translation initiation sites within coding sequences drive the expression of N-terminally truncated proteoforms.
Ludhiana: Police arrested Aam Aadmi Party (AAP) worker and trader Anokh Mittal, his paramour and five contract killers for ...
LOS ANGELES (KTLA) – A deadly crash involving a wrong-way driver forced the closure of the southbound 405 Freeway through the ...
An unclaimed black box sent residents of north Delhi’s Prashant Vihar to panic on Saturday, leading to a traffic snarl and rushing of a police team. A PCR call regarding a suspicious box was received ...
The discovery of an unclaimed in New Delhi's Rohini sent the residents of Prashant Vihar into a state of panic on Saturday afternoon. This also led to a traffic jam and a swift response from local ...
Learn more There's a lot to consider when choosing a litter box for your cat, including their unique preferences and your specific household needs. The best cat litter boxes come in a range of ...
A new Executive team and structure supports ELC's ‘Beauty Reimagined’ action plan—and includes a new Packaging & Engineering leader. Stéphane de La Faverie, President and CEO of The Estée Lauder ...
CNET’s expert staff reviews and rates dozens of new products and services each month, building on more than a quarter century of expertise.
Box breathing is a deep breathing technique that can help lower blood pressure and aid in pain or COPD management. It’s also a powerful stress reliever and may help manage anxiety. Box breathing ...
Reverse transcription–polymerase chain reaction (RT-PCR). RNA was subjected to reverse transcription and PCR using Fcα/μR-specific primers (5′–AGTGTTACCACGAGTGAAGG–3′ and 5 ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results