News
Two pairs of primers (PQS1Mut-F1 and PQS1Mut-R1, PQS1Mut-F2 and PQS1Mut-R2 ... Lane 1, RNA ladder (p15, m17, m20 and m42 in Table S1); lanes 2, no Braco19 control; lanes 3 and 4, 0.5 and 1 µM ...
The marker used in this experiment was a mixture of P15 (UAAUACGACUCACUA), M17 (UAAUACGACUCACUAUAUA), and M20 (UAAUACGACUCACUAUACGA ... Two pairs of primers (PQS1Mut-F1 and PQS1Mut-R1, PQS1Mut-F2 and ...
We already have R2 models out in the wild, completing validation testing, and the American automaker just announced a $5,000 discount throughout June on all Tri-Motor versions of its R1 models.
Grace Cockrell Mississippi State University TCU has hired a new vice provost for research as the university aims to gain “R1” status over the next decade. Reuben F. Burch V begins in the role ...
Nvidia CEO Jensen Huang praised DeepSeek R1 for significant contributions to AI research. DeepSeek has made a "real impact" in how people think about inference and reasoning AI, Huang said.
Zak Calisto, the founder and CEO of Karooooo, is looking to sell $75 million (R1.3 billion) of his shares in the company. Calisto owns 65% of Karooooo shares, with another 10% of the company tied ...
As Jony Ive and Sam Altman work toward an AI gadget for release in 2026, the former chief Apple designer called last year’s Pin and R1 ‘poor products.’ As Jony Ive and Sam Altman work ...
The Momentum Group has started a R1 billion share buyback, as the group’s normalised headline earnings reach R4.8 billion. The group said the positive trajectory established in its interim ...
Aurora Mobile Limited announced the integration of DeepSeek-R1-0528, an advanced open-source reasoning AI model, into its enterprise AI platform, GPTBots.ai. This integration enhances GPTBots.ai's ...
More than 30 countries offer uncapped Starlink roaming subscriptions that South Africans can use to access the cutting-edge satellite Internet service locally for less than R1,500 per month.
Picture: X/PresidencyZA CAPE TOWN - President Cyril Ramaphosa said the country was making advances towards building the green hydrogen industry, with more than R1.49 billion invested in hydrogen ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results